Sequence ID | >SRA1033656 |
Genome ID | SRR035088.314559 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 103 |
End posion on genome | 26 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaccgaaca |
tRNA gene sequence |
GGGCCCATAGCTCAGCCTGGTTAGAGCACCGGACTCATAATCCGTTGGTCCAAGGTTCAA |
Downstream region at tRNA end position |
ctcattttat |
Secondary structure (Cloverleaf model) | >SRA1033656 Met CAT a ACCG ctcattttat G - C G - C G - C C - G C - G C - G A - T T A T G T T C C A C C G A A | | | | | A T C T C G C A A G G C G | | | | T T G G A G C T T A A TGGTC C T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |