Sequence ID | >SRA1033817 |
Genome ID | SRR035088.363463 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 177 |
End posion on genome | 103 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
atagaagcaa |
tRNA gene sequence |
AGGGACGTGGTGAAACGGCTATCATGGAAATCTCCAAAATTTCTGTTCCAGGTTCGAATC |
Downstream region at tRNA end position |
tacgagacat |
Secondary structure (Cloverleaf model) | >SRA1033817 Trp CCA a GCCA tacgagacat A - T G - C G - C G - C A - T C - G G - C T A T G G T C C A C A A G | | | | | G G A G T G C C A G G C G | | | + T T C T C A T T A G TGTT G - C A - T A - T A - T T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |