Sequence ID | >SRA1033836 |
Genome ID | SRR035088.369690 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 194 |
End posion on genome | 119 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aagttcatgg |
tRNA gene sequence |
GGGCCGGTAGCTCAGTTGGTAGAGCACGGCACTTTTAATGCTGGGGTCGCGGGTTCAAAT |
Downstream region at tRNA end position |
tgtgattgtc |
Secondary structure (Cloverleaf model) | >SRA1033836 Lys TTT g ACCA tgtgattgtc G - C G + T G - C C - G C - G G - C G - C T A T C G C C C A T G A A | | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T G - C C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |