Sequence ID | >SRA1033855 |
Genome ID | SRR035088.378917 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 230 |
End posion on genome | 153 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctttaatcgt |
tRNA gene sequence |
GGCGGCGTAGCTCAGGTGGTTAGAGCATACGGCTCATATCCGTAGTGTCCGGGGGTTCGA |
Downstream region at tRNA end position |
ttcatccccc |
Secondary structure (Cloverleaf model) | >SRA1033855 Met CAT t ACCA ttcatccccc G - C G - C C - G G - C G - C C - G G - C T G T G T C C C A G G A A + | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTCC T - A A - T C - G G - C G - C C T T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |