Sequence ID | >SRA1033958 |
Genome ID | SRR035088.424048 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001809) |
Species | |
Start position on genome | 198 |
End posion on genome | 114 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttttttgaat |
tRNA gene sequence |
GGGGAGATACCCTAGCGGTCAAAGGGAGCAGACTGTAAATCTGCCGGCGAAGCCTACGGA |
Downstream region at tRNA end position |
tatattgcgg |
Secondary structure (Cloverleaf model) | >SRA1033958 Tyr GTA t ACCA tatattgcgg G - C G - C G - C G - C A - T G - C A - T T A T C T T C C A C G A A | + | | | A G T C C C G G A G G C G | | | | T T T A G G G C A A A CGGCGAAGCCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |