Sequence ID | >SRA1034241 |
Genome ID | SRR035089.33763 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 306 |
End posion on genome | 234 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tgaattcagt |
tRNA gene sequence |
GCCGCTATAGCTCAGTTGGTAGAGCGACGGTTTTGTAAACCGTTTGTCGCTGGTTCGACT |
Downstream region at tRNA end position |
taattgggtc |
Secondary structure (Cloverleaf model) | >SRA1034241 Thr TGT t Ttat taattgggtc G - C C - G C - G G - C C - G T - A A - T T C T C G G C C A T G A A | | + | | G T C T C G G C T G G C G | | | | T T G G A G C T A G TTGTC A - T C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |