Sequence ID | >SRA1034243 |
Genome ID | SRR035089.33842 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 110 |
End posion on genome | 34 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccggcactaa |
tRNA gene sequence |
GGACGAGTAGCTCAGCTGGTTAGAGTGTCTCTCTTACACAGAGAAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
aaatatgata |
Secondary structure (Cloverleaf model) | >SRA1034243 Val TAC a AACA aaatatgata G - C G - C A - T C - G G - C A - T G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | + T T G G A G T T T A G AGGTC T - A C - G T - A C - G T - A C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |