Sequence ID | >SRA1034460 |
Genome ID | SRR035089.100765 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 230 |
End posion on genome | 305 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tttttatgtg |
tRNA gene sequence |
GTGGATGTAGTTCAATGGCAGAGTCACCGGATTGTGGTTCCGGTTGTTGTGGGTTCGAGT |
Downstream region at tRNA end position |
tcttttattt |
Secondary structure (Cloverleaf model) | >SRA1034460 His GTG g CCCA tcttttattt G - C T - A G - C G - C A - T T - A G - C T G T T A C C C A T A A A + | | | | G G C T T G G T G G G C G + | T T C A G T C A G A TTGTT C - G C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |