Sequence ID | >SRA1034473 |
Genome ID | SRR035089.103838 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 234 |
End posion on genome | 142 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
taaaattctC |
tRNA gene sequence |
GGAGAGGTCGCATAGCCCGGTTTAGTGCGGCGGTTTGCTAAATCGCTGTACGGGGAAACC |
Downstream region at tRNA end position |
ttttacttgt |
Secondary structure (Cloverleaf model) | >SRA1034473 Ser GCT C GTtg ttttacttgt G - C G - C A - T G - C A - T G - C G - C T A T G T C C C A C C G A C | | | | | G C T A C G C A G G G C G + | | | T T G G T G C T T T A G TGTACGGGGAAACCCGTACC G - C C - G G - C G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |