Sequence ID | >SRA1034497 |
Genome ID | SRR035089.110167 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 112 |
End posion on genome | 188 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
ctgaacttag |
tRNA gene sequence |
GCTCCTGTAGCTCAACTGGATAGAGCGTCTGGCTTCGGACCAGAAGGTTGTAGGTTCGAG |
Downstream region at tRNA end position |
ttgacttttt |
Secondary structure (Cloverleaf model) | >SRA1034497 Arg TCG g ACCA ttgacttttt G - C C - G T - A C - G C - G T + G G - C T G T C G T C C A C A A A | + | | | G T C T C G G T A G G C G | | | | T T G G A G C A T A G AGGTT T - A C - G T - A G - C G - C C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |