Sequence ID | >SRA1034532 |
Genome ID | SRR035089.116607 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 305 |
End posion on genome | 381 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
accccaccat |
tRNA gene sequence |
GCCGAAATAGCTCAACCTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGCGGGTTCAAC |
Downstream region at tRNA end position |
ttaaagccta |
Secondary structure (Cloverleaf model) | >SRA1034532 Thr TGT t ACCA ttaaagccta G - C C - G C - G G - C A - T A - T A - T T C T C G T C C A C A A A | | + | | A C C T C G G C G G G C T | | | | T T G G A G C G T A A AGGTT A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |