Sequence ID | >SRA1034596 |
Genome ID | SRR035089.131205 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 323 |
End posion on genome | 397 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cccccactat |
tRNA gene sequence |
GGTCCCATCGTCTAGCGGCTAGGACGCTGGCCTCTCACGCCGGAAACCGGGGTTCAATTC |
Downstream region at tRNA end position |
gaaatattat |
Secondary structure (Cloverleaf model) | >SRA1034596 Glu CTC t ACCA gaaatattat G + T G - C T - A C - G C - G C - G A - T T T T G C C C C A C G A C | | | | | A G T C T G C G G G G C G + | | | T T C G G A C T A G AAAC C - G T + G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |