Sequence ID | >SRA1034673 |
Genome ID | SRR035089.148507 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 72 |
End posion on genome | 1 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
agtagtacct |
tRNA gene sequence |
GCCCCTATAGTACAACGGCCAGTACATCTGTTTTGTAATCAGAAAATGAGTGTTCGATTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1034673 Thr TGT t Tnnn nnnnnnnnnn G - C C - G C - G C - G C - G T - A A - T T T T C T T A C A C A A A | | + | | G G C A T G G A G T G C G | | | | T T C G T A C C A A AAAT T - A C - G T - A G - C T T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |