Sequence ID | >SRA1034748 |
Genome ID | SRR035089.166171 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 6 |
End posion on genome | 82 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnnnaattt |
tRNA gene sequence |
GGCGAGGTAGCTCAGGTGGTTAGAGCGTTTGATTCATAATCAAGAGGTCCCGGGTTCAAG |
Downstream region at tRNA end position |
agcccggata |
Secondary structure (Cloverleaf model) | >SRA1034748 Met CAT t ACAA agcccggata G + T G - C C - G G - C A - T G - C G + T T G T G G C C C A G G A A | | | | | A T C T C G C C G G G C G | | | | T T G G A G C T T A G AGGTC T + G T - A T - A G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |