Sequence ID | >SRA1034761 |
Genome ID | SRR035089.168579 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 90 |
End posion on genome | 165 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tcaatcttgT |
tRNA gene sequence |
CGGGGCGTAGCGCAGCTTGGTAGCGCGCTTGGTTCGGGACCAAGAAGTCGAGGGTTCAAA |
Downstream region at tRNA end position |
tcttgcatcg |
Secondary structure (Cloverleaf model) | >SRA1034761 Pro CGG T ATtt tcttgcatcg C - G G - C G - C G - C G - C C - G G - C T A T C T C C C A C G A A | | | | | A T C G C G G A G G G C T | | | | T T G G C G C G T A G AAGTC C - G T - A T - A G - C G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |