Sequence ID | >SRA1034796 |
Genome ID | SRR035089.174737 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 308 |
End posion on genome | 384 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
atctcgttgt |
tRNA gene sequence |
GGGGGCGTGGCGAAGCTGGTTATCGCGCCGGCCTGTCAAGCCGGAGATCGCGGGTTCAAT |
Downstream region at tRNA end position |
acttttaaaa |
Secondary structure (Cloverleaf model) | >SRA1034796 Asp GTC t GCCT acttttaaaa G - C G - C G - C G + T G - C C - G G - C C T T T G C C C A C G A G + | | | | A T A G C G G C G G G C G | | | | T T G T C G C T T A G AGATC C - G C - G G - C G - C C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |