| Sequence ID | >SRA1034807 |
| Genome ID | SRR035089.177661 |
| Phylum/Class | 454 Sequencing (SRP001810) |
| Species | |
| Start position on genome | 4 |
| End posion on genome | 80 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
nnnnnnntgt |
| tRNA gene sequence |
CGGGATGTGGCCCAGCCTGGTAGGGCACTGCGTTCGGGACGCAGGAGTCGCGCGTTCAAA |
| Downstream region at tRNA end position |
tttttttgct |
| Secondary structure (Cloverleaf model) | >SRA1034807 Pro CGG
t ACCA tttttttgct
C - G
G - C
G - C
G - C
A - T
T - A
G - C T A
T C G C G C A
C G A G | | | | | A
C C C C G G C G C G C
T | | | | T T
G G G G C
G T A A GAGTC
C - G
T - A
G - C
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |