Sequence ID | >SRA1034867 |
Genome ID | SRR035089.188676 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 137 |
End posion on genome | 65 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcagtagaaC |
tRNA gene sequence |
TCGGGGATCGTCTAAGGGTAGGACAGCTGGTTTTGATCCAGCCAATCCAGGTTCGAATCC |
Downstream region at tRNA end position |
tgctgcggag |
Secondary structure (Cloverleaf model) | >SRA1034867 Gln TTG C GTtc tgctgcggag T - A C - G G - C G - C G - C G - C A - T T A T G G T C C A A A C | | | | | G G T C T G C C A G G C G + | | | T T G G G A C T A A CAAT G - C C - G T - A G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |