Sequence ID | >SRA1034934 |
Genome ID | SRR035089.202334 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 101 |
End posion on genome | 178 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
attttaaaat |
tRNA gene sequence |
GGGCCGGTGGAGCAGTCTGGAGTGCTCGGATCCCTGTCACGGATCAGGTCACGGGTTCAA |
Downstream region at tRNA end position |
attttttttt |
Secondary structure (Cloverleaf model) | >SRA1034934 Asp GTC t GCTA attttttttt G - C G - C G - C C - G C - G G - C G - C T A T T G C C C A C T G A G | | | | | A T C G A G A C G G G C G | | | | T T G G C T C A G T G AGGTC G - C A - T T - A C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |