Sequence ID | >WENV030432 |
Genome ID | AACY021282175 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 270 |
End posion on genome | 346 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaaaattaaa |
tRNA gene sequence |
GGGCATGTAGCTCAGTTGGATAGAGCATCAGATTCCGGTTCTGAGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
cattttttaa |
Secondary structure (Cloverleaf model) | >WENV030432 Arg CCG a GTAA cattttttaa G - C G + T G - C C - G A - T T - A G - C T A T T T C C C A T G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC T - A C - G A - T G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |