Sequence ID | >SRA1035064 |
Genome ID | SRR035089.230184 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 254 |
End posion on genome | 329 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
cattttaggt |
tRNA gene sequence |
GCACCCATAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
ttttttttat |
Secondary structure (Cloverleaf model) | >SRA1035064 Lys CTT t ACCA ttttttttat G + T C - G A - T C - G C - G C - G A - T C G T G G C C C A T G A A | + | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |