Sequence ID | >SRA1035100 |
Genome ID | SRR035089.237669 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 383 |
End posion on genome | 306 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gctttatcaT |
tRNA gene sequence |
ACTCCGGTAGCTCAGTTGGACAGAGCAGCTGATTCCTAATCAGCAGGTCGCGCGTTCAAG |
Downstream region at tRNA end position |
tttgtttatc |
Secondary structure (Cloverleaf model) | >SRA1035100 Arg CCT T ACCC tttgtttatc A - T C - G T + G C - G C - G G - C G - C T G T C G C G C A T G A A | | | | | A T C T C G G C G C G C G | | | | T T G G A G C A C A A AGGTC G - C C - G T - A G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |