Sequence ID | >SRA1035183 |
Genome ID | SRR035089.255778 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 266 |
End posion on genome | 191 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tgcctactcc |
tRNA gene sequence |
GGGCCGCTAGCTCAAACGGCAGAGCAGCTGACTCTTAATCAGCAGGTTCAGGGTTCGATT |
Downstream region at tRNA end position |
taaaatgaag |
Secondary structure (Cloverleaf model) | >SRA1035183 Lys CTT c ACCA taaaatgaag G - C G + T G - C C - G C - G G - C C - G T T T G T C C C A A A A A | | | | | G C C T C G C A G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |