Sequence ID | >SRA1035191 |
Genome ID | SRR035089.256794 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 146 |
End posion on genome | 222 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atttgactga |
tRNA gene sequence |
GGCGGTGTAGCTCAGATGGTTAGAGCATACGGCTCATATCCGTAGTGTCCGGGGTTCAAT |
Downstream region at tRNA end position |
tgaatttaag |
Secondary structure (Cloverleaf model) | >SRA1035191 Met CAT a ACCA tgaatttaag G - C G - C C - G G - C G - C T - A G - C T T T G T C C C A A G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC T - A A - T C - G G - C G - C C T T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |