Sequence ID | >SRA1035275 |
Genome ID | SRR035089.273001 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 331 |
End posion on genome | 258 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ttctagtagt |
tRNA gene sequence |
GGGGGATTAGTCTAGCGGTAGGACGACTGATTCTGGATCAGTTAGGCCAGGTTCGAATCC |
Downstream region at tRNA end position |
atttattata |
Secondary structure (Cloverleaf model) | >SRA1035275 Gln CTG t GCCA atttattata G A G - C G - C G - C G - C A - T T - A T A T G G T C C A G A A | | | | | G C T C T G C C A G G C G + | | | T T G G G A C T A G TAGG A - T C - G T - A G - C A - T T A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |