Sequence ID | >SRA1035418 |
Genome ID | SRR035089.301434 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 341 |
End posion on genome | 413 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cacaactgat |
tRNA gene sequence |
GCCTCCATAACTCAGTTGGTAGAGTGTCTGGCTGTTAACCAGAATGTCACAGGTTCGAGT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1035418 Asn GTT t Gnnn nnnnnnnnnn G - C C - G C - G T + G C - G C - G A - T T G T T G T C C A T G A A | | | | | G T C T C A A C A G G C G | | | | T T G G A G T T A G ATGTC T - A C - G T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |