Sequence ID | >SRA1035422 |
Genome ID | SRR035089.301650 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 393 |
End posion on genome | 318 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gacacctcgt |
tRNA gene sequence |
CGGGATGTGGCGCAATTGGTAGCGCACTCGCTTTGGGAGCGAGGGGTTGCCAGTTCGAGT |
Downstream region at tRNA end position |
ttttctttct |
Secondary structure (Cloverleaf model) | >SRA1035422 Pro TGG t ACCA ttttctttct C - G G - C G - C G - C A - T T - A G - C T G T C G G T C A T A A G | | | | | G T C G C G G C C A G C G | | | | T T G G C G C T A A GGGTT C - G T - A C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |