| Sequence ID | >SRA1035436 |
| Genome ID | SRR035089.303501 |
| Phylum/Class | 454 Sequencing (SRP001810) |
| Species | |
| Start position on genome | 103 |
| End posion on genome | 179 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
ctcaatctgt |
| tRNA gene sequence |
GGGTGATTAGCTCAGATGGTTAGAGTGCTACGTTGACATCGTAGAGGTCACTGGTTCGAT |
| Downstream region at tRNA end position |
tttttaattt |
| Secondary structure (Cloverleaf model) | >SRA1035436 Val GAC
t ACCA tttttaattt
G - C
G - C
G - C
T - A
G - C
A - T
T - A T T
T T G A C C A
A G A A | | | | | G
T C T C G A C T G G C
G | | | + T T
G G A G T
T T A G AGGTC
C - G
T - A
A - T
C - G
G - C
T T
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |