Sequence ID | >SRA1035465 |
Genome ID | SRR035089.310082 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 108 |
End posion on genome | 37 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
taattatcaa |
tRNA gene sequence |
GGACTCGTGGTCTAGTGGTATGATATCGCCTTCACATGGCGAAGGTCGCCGGTTCAATTC |
Downstream region at tRNA end position |
aattttttcc |
Secondary structure (Cloverleaf model) | >SRA1035465 Val CAC a Aatt aattttttcc G - C G - C A - T C - G T + G C - G G - C T T T C G G C C A G A G | | | | | A T T C T G G C C G G C G | | + T T G T G A T T A A AGGTC T - A C - G G - C C - G C - G T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |