Sequence ID | >SRA1035514 |
Genome ID | SRR035089.321912 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 35 |
End posion on genome | 122 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ctttgccact |
tRNA gene sequence |
GGAGAGGTGACCGAGTGGCCGATGGTGCCGTTCTCGAAAAGCGGTGGGCAGAAATGTCCC |
Downstream region at tRNA end position |
gaaggtctat |
Secondary structure (Cloverleaf model) | >SRA1035514 Ser CGA t GCCA gaaggtctat G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | A G G C C A G T G G G C G + | | | T T C T G G T C G A G TGGGCAGAAATGTCCC C - G C - G G - C T + G T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |