Sequence ID | >SRA1035558 |
Genome ID | SRR035089.330324 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 195 |
End posion on genome | 109 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tttaattcat |
tRNA gene sequence |
GCCGAAGTGGTGGAATTTGGTAGACACGCTATCTTGAGGGGGTAGTGGGCACAACCCGTC |
Downstream region at tRNA end position |
taagaaaaac |
Secondary structure (Cloverleaf model) | >SRA1035558 Leu GAG t ACCA taagaaaaac G - C C - G C - G G - C A - T A - T G - C T G T G G G C C A T T A A G | | | | | A T G G T G C C C G G C G | | | T T G A C A C T A G G TGGGCACAACCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |