Sequence ID | >SRA1035571 |
Genome ID | SRR035089.332756 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 110 |
End posion on genome | 185 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tgaaaataat |
tRNA gene sequence |
GCCCCCATCGTCTAGGGGTTTAGGACACCGCCCTTTCACGGCGGCGACAGGGGTTCAAAT |
Downstream region at tRNA end position |
tattttttaa |
Secondary structure (Cloverleaf model) | >SRA1035571 Glu TTC t ACCA tattttttaa G + T C - G C - G C - G C - G C - G A - T T A T T C C C C A G G A C | | | | | A G T C T G A G G G G C G + | | | T T T G G A C T T A A CGAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |