Sequence ID | >SRA1035588 |
Genome ID | SRR035089.335991 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 65 |
End posion on genome | 141 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tattttttgc |
tRNA gene sequence |
GGGGTCGTAGTTAAGCTGGTTATAACGCCGGCCTGTCACGCCGGAGGCCAGGGGTTCGAG |
Downstream region at tRNA end position |
taaatattaa |
Secondary structure (Cloverleaf model) | >SRA1035588 Asp GTC c GCCA taaatattaa G - C G - C G - C G - C T - A C - G G - C T G T T C C C C A C G A A | | | | | G T A T T G A G G G G C G | | | | T T G T A A C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |