Sequence ID | >SRA1035665 |
Genome ID | SRR035089.351647 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 234 |
End posion on genome | 160 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tagccctcta |
tRNA gene sequence |
GGCCCCATCGTCTAGTGGCTAGGACACCAGGTTCTCATCCTGGCAACCAGAGTTCGATTC |
Downstream region at tRNA end position |
acttatttac |
Secondary structure (Cloverleaf model) | >SRA1035665 Glu CTC a ACAA acttatttac G - C G + T C - G C - G C - G C - G A - T T T T G T C T C A T G A C | | | | | G G T C T G C A G A G C G + | | | T T C G G A C T A A CAAC C - G C - G A - T G - C G - C T T T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |