Sequence ID | >SRA1035767 |
Genome ID | SRR035089.372404 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 102 |
End posion on genome | 26 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
caccaaatat |
tRNA gene sequence |
GTCTCCTTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
acttttcggt |
Secondary structure (Cloverleaf model) | >SRA1035767 Arg TCT t ACCA acttttcggt G - C T - A C - G T + G C - G C - G T - A T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |