Sequence ID | >SRA1035838 |
Genome ID | SRR035089.385389 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 271 |
End posion on genome | 187 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aaattattga |
tRNA gene sequence |
GCGGATGTGGCGAAATTGGTAGACGCGCTAGACTTAGGATCTAGTGTCGCGAGACGTGGG |
Downstream region at tRNA end position |
attaaggatt |
Secondary structure (Cloverleaf model) | >SRA1035838 Leu TAG a ACAA attaaggatt G - C C - G G - C G - C A - T T - A G - C T G T T T C C C A T A A G + + | | | G T A G C G G G G G G C G | | | T T G A C G C T A G G TGTCGCGAGACGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |