Sequence ID | >SRA1035856 |
Genome ID | SRR035089.389558 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 554 |
End posion on genome | 479 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tatctccacT |
tRNA gene sequence |
TGCCCTGTAGCTCAGTAGGATAGAGCAACGGTTTCCTAAACCGTGTGTCGGGCGTTCGAG |
Downstream region at tRNA end position |
ccaggttgcc |
Secondary structure (Cloverleaf model) | >SRA1035856 Arg CCT T ATga ccaggttgcc T T G G C - G C - G C - G T - A G - C T G T C C C G C A T G A A | | | | | G A C T C G G G G C G C G | | | | T T G G A G C A T A A GTGTC A - T C - G G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |