| Sequence ID | >SRA1035939 |
| Genome ID | SRR035089.409426 |
| Phylum/Class | 454 Sequencing (SRP001810) |
| Species | |
| Start position on genome | 199 |
| End posion on genome | 273 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gctggacctt |
| tRNA gene sequence |
CGGGGCGTAGCTCAGCTTGGTAGAGCGCCCGCTTTGGGAGCGGGAGGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
acacacacat |
| Secondary structure (Cloverleaf model) | >SRA1035939 Pro TGG
t ACgg acacacacat
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T T G T C C A
C G A A + | | | | G
T C T C G G C A G G C
T | | | | T T
G G A G C
G T A G AGGTC
C - G
C - G
C - G
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |