| Sequence ID | >SRA1035951 |
| Genome ID | SRR035089.412085 |
| Phylum/Class | 454 Sequencing (SRP001810) |
| Species | |
| Start position on genome | 230 |
| End posion on genome | 154 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
tatttgtttg |
| tRNA gene sequence |
CGGGGTGTAGCTCAGCCTGGTTTAGAGCGCCTGCTTTGGGAGCAGGAAGTCGGAGGTTCG |
| Downstream region at tRNA end position |
ggtgtacaat |
| Secondary structure (Cloverleaf model) | >SRA1035951 Pro TGG
g ACag ggtgtacaat
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T T C T C C A
C C G A A + | | | | G
T C T C G G G A G G C
G | | | | T T
G G A G C
T T T A G AAGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |