Sequence ID | >SRA1036073 |
Genome ID | SRR035089.438285 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 385 |
End posion on genome | 294 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ttttttttgt |
tRNA gene sequence |
GGAGAGATGCCGGAGCGGTTGAACGGGACGGTCTCGAAAATCGTTGTCCGTCGTTTGGCG |
Downstream region at tRNA end position |
tttgtaaatt |
Secondary structure (Cloverleaf model) | >SRA1036073 Ser CGA t GCCA tttgtaaatt G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A C G A G | | | | | G G G G C C G T G G G C G | | | T T T A C G G T G A G TGTCCGTCGTTTGGCGGACC A - T C - G G - C G + T T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |