Sequence ID | >SRA1036207 |
Genome ID | SRR035089.471408 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 101 |
End posion on genome | 25 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
caaatggaga |
tRNA gene sequence |
GGGCCTATAGCTCAGTAGGTTAGAGCGCATCCCTGATAAGGATGAGGTCTCTGGTTCGAG |
Downstream region at tRNA end position |
ctataattgt |
Secondary structure (Cloverleaf model) | >SRA1036207 Ile GAT a ACCA ctataattgt G - C G - C G - C C - G C - G T - A A - T T G T A G A C C A T G A A | | | | | G A C T C G T C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |