Sequence ID | >SRA1036225 |
Genome ID | SRR035089.474550 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001810) |
Species | |
Start position on genome | 211 |
End posion on genome | 127 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcgttaaagt |
tRNA gene sequence |
GCGGATGTAGCCGAATTTGGTATAGGCGCAGGACTTAGGATCCTGTAGAGAAATCTACTG |
Downstream region at tRNA end position |
cttacaaaaa |
Secondary structure (Cloverleaf model) | >SRA1036225 Leu TAG t ACat cttacaaaaa G - C C - G G - C G - C A - T T - A G - C T T T C T C C C A T T A A A | | | | | G T G C C G G A G G G C G | | | T T G A G G C T A T G TAGAGAAATCTACT C - G A - T G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |