| Sequence ID | >SRA1036534 |
| Genome ID | SRR035089.541175 |
| Phylum/Class | 454 Sequencing (SRP001810) |
| Species | |
| Start position on genome | 167 |
| End posion on genome | 250 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
ttacctaatc |
| tRNA gene sequence |
GCCGGAGTGATGGAATTGGCAGACGTGCTGGATTCAAAATCCAGTCTTCGAAAGAAGGTG |
| Downstream region at tRNA end position |
taaatgcctt |
| Secondary structure (Cloverleaf model) | >SRA1036534 Leu CAA
c Attt taaatgcctt
G - C
C - G
C - G
G - C
G - C
A - T
G - C T C
T C T C C C A
T A A G | | | | | A
T G G T A G A G G G C
G | + | T T
G A C G T
C A G G TCTTCGAAAGAAGGT
C - G
T - A
G - C
G - C
A - T
T A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |