| Sequence ID | >SRA1036576 |
| Genome ID | SRR035089.553754 |
| Phylum/Class | 454 Sequencing (SRP001810) |
| Species | |
| Start position on genome | 15 |
| End posion on genome | 91 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
atcaattatt |
| tRNA gene sequence |
GCCCCCGTAGCTCAGGTGGATAGAGCATCAGATTCCTAATCTGGGTGTCGTGCGTTCGAG |
| Downstream region at tRNA end position |
aacaaactca |
| Secondary structure (Cloverleaf model) | >SRA1036576 Arg CCT
t ACCA aacaaactca
G - C
C - G
C - G
C - G
C - G
C - G
G - C T G
T C G C G C A
G G A A | + | | | G
T C T C G G T G C G C
G | | | | T T
G G A G C
A T A A GTGTC
T + G
C - G
A - T
G - C
A - T
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |