Sequence ID | >SRA1036844 |
Genome ID | SRR035090.22996 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 89 |
End posion on genome | 15 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tgtttcatga |
tRNA gene sequence |
GGGCAATTAGCTCAGTTGGTTAGAGCGCTTGCTTCACACGCAAGAGGTCAGTGGTTCGAA |
Downstream region at tRNA end position |
cctcaccagc |
Secondary structure (Cloverleaf model) | >SRA1036844 Val CAC a ACac cctcaccagc G - C G - C G - C C - G A - T A - T T - A T A T T C A C C A T G A A | | | | | G T C T C G A G T G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A T - A G - C C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |