Sequence ID | >SRA1037191 |
Genome ID | SRR035090.90994 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 166 |
End posion on genome | 253 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tattttacac |
tRNA gene sequence |
GGAGAGGTCGCATAGTGGTCTAGTGCGCTCGCCTGGAAAGCGGGTAGGGTGTAACAGCCC |
Downstream region at tRNA end position |
gcagtaacga |
Secondary structure (Cloverleaf model) | >SRA1037191 Ser GGA c GCag gcagtaacga G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A C | | | | | G G T A C G G A G G G C G + | | | T T T G T G C C T A G TAGGGTGTAACAGCCCTC C - G T + G C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |