Sequence ID | >SRA1037238 |
Genome ID | SRR035090.99993 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 389 |
End posion on genome | 317 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gaagttcttt |
tRNA gene sequence |
TGAGGAGTGGCCAAATGGTAAGGCTCCTGATTCTGGATCAGGCAACTGCAGGTTCGAGTC |
Downstream region at tRNA end position |
cgataaagcc |
Secondary structure (Cloverleaf model) | >SRA1037238 Gln CTG t GCat cgataaagcc T - A G - C A - T G - C G - C A - T G - C T G T C G T C C A A A G | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A T CAACT C - G C - G T - A G - C A - T T A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |