| Sequence ID | >SRA1037298 |
| Genome ID | SRR035090.109596 |
| Phylum/Class | 454 Sequencing (SRP001811) |
| Species | |
| Start position on genome | 24 |
| End posion on genome | 96 |
| Amino Acid | Arg |
| Anticodon | CCG |
| Upstream region at tRNA start position |
agctgtttta |
| tRNA gene sequence |
GCGCCCGTAGTTAATATGGATATAATAGAGGTCTCCGAAGCCTTAGTTGCAGGTTCGATT |
| Downstream region at tRNA end position |
tgtttaattc |
| Secondary structure (Cloverleaf model) | >SRA1037298 Arg CCG
a Aaaa tgtttaattc
G - C
C - G
G - C
C - G
C - G
C - G
G + T T T
T C G C T C A
A T A A | | + | G
T A T T G G C A G G C
G | | | + T T
G T A A T
A T A A AGTT
G + T
A - T
G - C
G - C
T + G
C A
T A
C C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |