Sequence ID | >SRA1037472 |
Genome ID | SRR035090.139387 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 111 |
End posion on genome | 202 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tccttaaaat |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTCGAAAGCGGCACACTGCTAATGTGTTGTCTGGGTCAAACCG |
Downstream region at tRNA end position |
aaaaatacaa |
Secondary structure (Cloverleaf model) | >SRA1037472 Ser GCT t GCCA aaaaatacaa G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T G A G | | | | | G G G T C G G C G G G C G | | | T T T A A G C C G A G TGTCTGGGTCAAACCGGACC G + T C - G A - T C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |