| Sequence ID | >SRA1037523 |
| Genome ID | SRR035090.147402 |
| Phylum/Class | 454 Sequencing (SRP001811) |
| Species | |
| Start position on genome | 175 |
| End posion on genome | 260 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
gtcgcctaaT |
| tRNA gene sequence |
GGTTGGGTGGCTGAGCGGTCAAAAGCAACGGTCTGTAAAACCGTCGGACTCCGTCCTACA |
| Downstream region at tRNA end position |
tattatgacg |
| Secondary structure (Cloverleaf model) | >SRA1037523 Tyr GTA
T ATtt tattatgacg
G - C
G - C
T - A
T - A
G - C
G - C
G - C T A
T T A T C C A
C G A G | | | | | G
G G T C G A T A G G C
G | | | T T
T A A G C
C A A A CGGACTCCGTCCTAC
A - T
C - G
G - C
G - C
T - A
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |